Saltar al contenido

¿Existe Dios? Pruebas científicas de que Dios existe

Pruebas científicas de que dios existe
Pruebas científicas de que dios existe

¿Sólo una vez no amarías a alguien para simplemente mostrarte la evidencia de la existencia de Dios? Sin torcer el brazo. Sin declaraciones de:”Sólo tienes que creer”. Bueno, aquí hay un intento de ofrecer cándidamente algunas de las razones que sugieren que Dios existe.

Pero primero considere esto. Cuando se trata de la posibilidad de la existencia de Dios, la Biblia dice que hay personas que han visto suficiente evidencias, pero que han suprimido la verdad acerca de Dios.

  • Por otro lado, para aquellos que quieren conocer a Dios si él está allí, dice:”Me buscarás y me hallarás; cuando me busques con todo tu corazón, seré hallado por ti.”
  • Antes de que mires los hechos que rodean su existencia, pregúntate: Si Dios existe, ¿quiero conocerlo? He aquí algunas razones para considerar…

La complejidad de nuestro planeta apunta a un Diseñador deliberado que no sólo creó nuestro universo, sino que lo sostiene hoy en día.

Muchos ejemplos que muestran el designio de Dios podrían ser dados, posiblemente sin fin. Pero aquí hay algunas:

La Tierra… su tamaño es perfecto. El tamaño de la Tierra y la gravedad correspondiente contienen una capa delgada de gases, principalmente nitrógeno y oxígeno, que se extienden sólo unos 80 Kilómetros por encima de la superficie terrestre.

Si la Tierra fuera más pequeña, una atmósfera sería imposible, como el planeta Mercurio.

Si la Tierra fuera más grande, su atmósfera contendría hidrógeno libre, como Júpiter.

La Tierra es el único planeta conocido equipado con una atmósfera de la mezcla correcta de gases para sostener la vida vegetal, animal y humana.

La Tierra está situada a la distancia correcta del sol. Considere las oscilaciones de temperatura que encontramos, aproximadamente -30 grados a +120 grados.

Si la Tierra estuviera más lejos del sol, todos nos congelaríamos. Un poco más cerca y nos quemaríamos. Incluso una variación fraccionaria en la posición de la Tierra con respecto al sol haría que la vida en la Tierra fuera imposible.

La Tierra permanece esta distancia perfecta del sol mientras gira alrededor del sol a una velocidad de casi 67,000 mph.

tierra catolica

También está rotando en su eje, permitiendo que toda la superficie de la Tierra sea adecuadamente calentada y enfriada todos los días.

Y nuestra luna es el tamaño perfecto y la distancia de la Tierra por su atracción gravitacional. La luna crea importantes mareas y movimientos oceánicos para que las aguas oceánicas no se estanquen, y sin embargo nuestros océanos masivos se ven impedidos de derramarse a través de los continentes.

Agua… incolora, inodora y sin sabor, y sin embargo ninguna cosa viviente puede sobrevivir sin ella. Las plantas, los animales y los seres humanos consisten principalmente en agua (aproximadamente dos tercios del cuerpo humano son agua).

Observa por qué las características del agua son especialmente adecuadas para la vida:

  • Tiene un amplio margen entre su punto de ebullición y su punto de congelación.
  • El agua nos permite vivir en un ambiente de fluctuantes cambios de temperatura.
  • El agua es un disolvente universal. Esta propiedad del agua significa que varios productos químicos, minerales y nutrientes pueden ser transportados a través de nuestro cuerpo y hacia los vasos sanguíneos más pequeños.
  • El agua también es químicamente neutra. Sin afectar la composición de las sustancias que transporta, el agua permite que los alimentos, medicamentos y minerales sean absorbidos y utilizados por el cuerpo.
  • El agua tiene una tensión superficial única. Por lo tanto, el agua en las plantas puede fluir hacia arriba contra la gravedad, trayendo agua y nutrientes que dan vida a la parte superior de los árboles más altos.
  • El agua se congela desde arriba hacia abajo y flota, por lo que los peces pueden vivir en invierno.
  • El 97% del agua de la Tierra está en los océanos. Pero en nuestra Tierra, hay un sistema diseñado que elimina la sal del agua y la distribuye por todo el planeta.
  • La evaporación toma las aguas del océano, dejando la sal, y forma nubes que son fácilmente movidas por el viento para dispersar el agua sobre la tierra, para la vegetación, los animales y las personas.
  • Es un sistema de purificación y suministro que sustenta la vida en este planeta, un sistema de agua reciclada y reutilizada.

El cerebro humano… simultáneamente procesa una cantidad asombrosa de información.

Tu cerebro absorbe todos los colores y objetos que ves, la temperatura a tu alrededor, la presión de tus pies contra el suelo, los sonidos que te rodean, la sequedad de tu boca, incluso la textura de tu teclado.

Tu cerebro retiene y procesa todas sus emociones, pensamientos y memorias. Al mismo tiempo, su cerebro lleva un registro de las funciones continuas de su cuerpo como su patrón respiratorio, el movimiento de los párpados, el hambre y el movimiento de los músculos de sus manos.

El cerebro humano procesa más de un millón de mensajes por segundo. Tu cerebro pesa la importancia de todos estos datos, filtrando los relativamente poco importantes.

Esta función de selección es lo que le permite concentrarse y operar eficazmente en su mundo. El cerebro funciona de manera diferente a otros órganos. Hay una inteligencia, la capacidad de razonar, de producir sentimientos, de soñar y de planificar, de actuar y de relacionarse con otras personas.

El ojo… puede distinguir entre siete millones de colores. Tiene enfoque automático y maneja un asombroso millón y medio de mensajes — simultáneamente.

La evolución se enfoca en mutaciones y cambios desde y dentro de los organismos existentes.

Sin embargo, la evolución por sí sola no explica completamente la fuente inicial del ojo o del cerebro, el comienzo de los organismos vivos a partir de la materia no viviente.

El universo tuvo un comienzo, ¿qué lo causó?

universo catolico

Los científicos están convencidos de que nuestro universo comenzó con una enorme explosión de energía y luz, que ahora llamamos el Big Bang. Este fue el comienzo singular de todo lo que existe: el principio del universo, el comienzo del espacio, e incluso el inicio inicial del tiempo mismo.

El astrofísico Robert Jastrow, autodescrito agnóstico, declaró:”La semilla de todo lo que ha sucedido en el Universo fue plantada en ese primer instante; cada estrella, cada planeta y cada criatura viviente del Universo surgió como resultado de eventos que fueron puestos en movimiento en el momento de la explosión cósmica…. El Universo resplandeció en el ser, y no podemos saber qué causó que eso ocurriera.”

Steven Weinberg, premio Nobel de Física, dijo en el momento de esta explosión,”el universo estaba a unos cien mil millones de grados centígrados… y el universo estaba lleno de luz.”

El universo no siempre ha existido. Tuvo un comienzo… ¿qué causó eso? Los científicos no tienen explicación para la repentina explosión de luz y materia.

El universo opera por leyes uniformes de la naturaleza. ¿Por qué lo hace?

Mucha de la vida puede parecer incierta, pero miren lo que podemos contar día tras día: la gravedad permanece constante, una taza de café caliente que queda en un mostrador se enfría, la tierra gira en las mismas 24 horas y la velocidad de la luz no cambia, en la tierra o en galaxias que están lejos de nosotros.

¿Cómo es que podemos identificar leyes de la naturaleza que nunca cambian? ¿Por qué el universo es tan ordenado, tan confiable?

“Los mejores científicos han sido sorprendidos por lo extraño que es esto. No hay necesidad lógica de un universo que obedezca reglas, y mucho menos de un universo que cumpla con las reglas de las matemáticas.

Este asombro surge del reconocimiento de que el universo no tiene que comportarse de esta manera. Es fácil imaginar un universo en el que las condiciones cambian de manera impredecible de un instante a otro, o incluso un universo en el que las cosas entran y salen de la existencia.”

Richard Feynman, ganador del Premio Nobel de electrodinámica cuántica, dijo:”Por qué la naturaleza es matemática es un misterio… El hecho de que haya reglas es una especie de milagro.”

El código ADN informa, programa el comportamiento de una célula.

adn genetico

Toda instrucción, toda enseñanza, todo entrenamiento viene con intención. Alguien que escribe un manual de instrucciones lo hace con propósito.

¿Sabías que en cada célula de nuestro cuerpo existe un código de instrucciones muy detallado, muy parecido a un programa de ordenador en miniatura?

Como sabrás, un programa de ordenador está formado por unos y ceros, como éste: 110010101010101111000. La forma en que están dispuestas le dice al programa de computadora qué hacer.

El código de ADN en cada una de nuestras células es muy similar. Se compone de cuatro sustancias químicas que los científicos abrevian como A, T, G y C. Éstas están dispuestas en la célula humana de esta manera: CGTGGTGACTCGCTCCTTGAT y así sucesivamente. ¡Hay tres mil millones de estas cartas en cada célula humana!

De la misma manera que puedes programar tu teléfono para que emita un pitido por razones específicas, ADN da instrucciones a la célula. El ADN es un programa de tres mil millones de letras que le dice a la célula que actúe de cierta manera. Es un manual de instrucciones completo.

¿Por qué es tan increíble? Uno tiene que preguntarse… ¿cómo acabó este programa de información en cada célula humana? No son sólo productos químicos. Estos son productos químicos que instruyen, ese código de una manera muy detallada exactamente cómo debe desarrollarse el cuerpo de la persona.

Las causas naturales y biológicas son completamente inexistentes como explicación cuando se trata de información programada. No se puede encontrar instrucción, información precisa como esta, sin que alguien la construya intencionalmente.

A diferencia de cualquier otra revelación de Dios, Jesucristo es la imagen más clara y específica de Dios revelándose a nosotros.

¿Por qué Jesús? Busca en las principales religiones del mundo y encontrarás que Buda, Mahoma, Confucio y Moisés se identificaron como maestros o profetas.

Ninguno de ellos afirmó ser igual a Dios. Sorprendentemente, Jesús lo hizo. Eso es lo que diferencia a Jesús de todos los demás. Dijo que Dios existe y tú lo estás mirando. Aunque hablaba de su Padre celestial, no era de la posición de separación, sino de una unión muy estrecha, única para toda la humanidad.

Jesús dijo que cualquiera que lo había visto había visto al Padre, cualquiera que creyera en él, creía en el Padre.

Él dijo:”Yo soy la luz del mundo, el que me sigue no andará en tinieblas, sino que tendrá la luz de la vida.”

Reclamaba atributos que pertenecían sólo a Dios: poder perdonar a la gente de su pecado, liberarla de los hábitos pecaminosos, dar a la gente una vida más abundante y darles vida eterna en el cielo.

A diferencia de otros maestros que enfocaban a la gente en sus palabras, Jesús señaló a la gente hacia sí mismo.

Nos dijo:”Sigue mis palabras y encontrarás la verdad”. Él dijo:”Yo soy el camino, la verdad y la vida; nadie viene al Padre sino por mí.”

¿Qué prueba dio Jesús para afirmar que era divino? Hizo lo que la gente no puede hacer. Jesús hizo milagros. Sanó a la gente… ciego, lisiado, sordo, incluso levantó a un par de personas de entre los muertos.

Tenía poder sobre los objetos… creó comida de la nada, suficiente para alimentar a miles de personas. Hizo milagros sobre la naturaleza… caminó en lo alto de un lago, ordenando a una furiosa tormenta que se detuviera para algunos amigos.

La gente en todas partes seguía a Jesús, porque él constantemente satisfacía sus necesidades, haciendo lo milagroso. Dijo que si no quieres creer lo que te estoy diciendo, al menos deberías creer en mí basándote en los milagros que estás viendo.

Jesucristo mostró que Dios era gentil, amoroso, consciente de nuestro egocentrismo y de nuestros defectos, pero deseando una relación profunda con nosotros.

Jesús reveló que aunque nos veía como pecadores, dignos de su castigo, su amor por nosotros gobernaba y tenía un plan diferente. Dios mismo tomó la forma de hombre y aceptó el castigo por nuestro pecado en nuestro nombre.

¿Suena ridículo? Tal vez, pero muchos padres cariñosos con mucho gusto cambiarían de lugar con su hijo en una sala de cáncer si pudieran. La Biblia dice que la razón por la cual amaríamos a Dios es porque él nos amó primero.

Jesús murió en nuestro lugar para que pudiéramos ser perdonados. De todas las religiones conocidas por la humanidad, sólo a través de Jesús verán a Dios alcanzando a la humanidad, proveyendo un camino para que tengamos una relación con él.

Jesús nos muestra un corazón divino de amor, respondiendo a nuestras necesidades, atrayéndonos hacia sí mismo. Debido a la muerte y resurrección de Jesús, nos ofrece hoy una vida nueva. Podemos ser perdonados, plenamente aceptados por Dios y genuinamente amados por Dios.

Él dice:”Os he amado con amor eterno, y por eso os he continuado mi fidelidad.” Este es Dios, en acción.

¿Existe Dios? Si quieres saberlo, investiga a Jesucristo. Se nos dice que “de tal manera amó Dios al mundo que dio a su Hijo unigénito, para que todo aquel que crea en él no se pierda, sino que tenga vida eterna.”

Dios no nos obliga a creer en él, aunque podría. Por el contrario, nos ha proporcionado pruebas suficientes de su existencia para que podamos responderle voluntariamente.

La distancia perfecta de la tierra del sol, las propiedades químicas únicas del agua, el cerebro humano, el ADN, el número de personas que atestiguan conocer a Dios, el roer en nuestros corazones y mentes para determinar si Dios está allí, la voluntad de que Dios sea conocido a través de Jesucristo.

Os dejo este impresionante vídeo donde explica lo dicho en este post, espero que os guste 😉